BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K931000 1 BBa_K931000 Starch Binding Protein (SBP) 2012-09-26T11:00:00Z 2015-05-08T01:13:47Z R. Oryzae, genomic DNA Starch binding protein, also known as Starch binding domain, is a protein from the gene CBM 21 of the organism, R. oryzae. Its functional purpose is to aid starch breakdown by binding to starch and providing an optimal interaction with the amylytic enzymes. Its substrates are diverse among the carbohydrate family. It has a high affinity for rice starch, corn starch, sweet potato starch, tapioca starch, and also wheat starch. false false _1196_ 0 13008 9 In stock false N/A false Joe Alexander BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation2214014 1 Help:Barcodes range2214014 1 682 706 annotation1014044 1 mrfp1 range1014044 1 1 675 BBa_K931002 1 BBa_K931002 A Red Fluorescent Protein - Starch Binding Protein Fusion 2012-09-30T11:00:00Z 2015-05-08T01:13:47Z Multiple A functional construct which contains a starch binding domain encoded by the gene CMB21 as well a red fluorescent protein encoded by the gene mRFP1. This construct was created from a plasmid for a constitutive promoter (BBa_J23117) that contained the RFP within it. A starch binding protein from the part (BBa_K931000) and a terminator from (BBa_K292000) were inserted into the plasmid. The CBM 21 domain is part of the amylolytic enzyme family utilized by organisms involved in carbohydrate degradation. When expressed, the protein bridges red fluorescent protein to a starch substrate. false false _1196_ 0 4759 9 It's complicated true N/A false Joe Alexander component2264709 1 BBa_B0034 component2264707 1 BBa_J23118 component2264712 1 BBa_E1010 component2264720 1 BBa_B0015 component2264713 1 BBa_K931000 annotation2264713 1 BBa_K931000 range2264713 1 776 1137 annotation2264709 1 BBa_B0034 range2264709 1 44 55 annotation2264707 1 BBa_J23118 range2264707 1 1 35 annotation2264720 1 BBa_B0015 range2264720 1 1146 1274 annotation2264712 1 BBa_E1010 range2264712 1 62 767 BBa_J23118 1 BBa_J23118 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K931002_sequence 1 ttgacggctagctcagtcctaggtattgtgctagctactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagaggaattcgcggccgcttctagaatggcatcgattccgagcagcgcgtccgttcagctggatagctacaactatgacggtagcaccttctccggtaaaatctacgtgaagaacattgcgtatagcaagaaagtgacggtcgtttatgctgatggttctgacaattggaataacaatggtaacatcattgcggccagcttcagcggtccgatttccggcagcaattatgagtactggacgtttagcgcaagcgttaagggcatcaaagagttttacatcaagtacgaagtcagcggcaaaacctattacgacaataacaatagcgcgaactaccaagtgtctaccactagtagcggccgctgcagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_K931000_sequence 1 gaattcgcggccgcttctagaatggcatcgattccgagcagcgcgtccgttcagctggatagctacaactatgacggtagcaccttctccggtaaaatctacgtgaagaacattgcgtatagcaagaaagtgacggtcgtttatgctgatggttctgacaattggaataacaatggtaacatcattgcggccagcttcagcggtccgatttccggcagcaattatgagtactggacgtttagcgcaagcgttaagggcatcaaagagttttacatcaagtacgaagtcagcggcaaaacctattacgacaataacaatagcgcgaactaccaagtgtctaccactagtagcggccgctgcag BBa_J23118_sequence 1 ttgacggctagctcagtcctaggtattgtgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z