BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_K932001 1 BBa_K932001 EnvZ Protein 2012-10-02T11:00:00Z 2015-05-08T01:13:47Z E. coli K-12 strain MG1655 EnvZ is a histidine kinase/phosphatase that regulates the phosphorylation state of the transcription factor OmpR, controlling the downstream expression of outer membrane porins OmpF and OmpC and the csgD regulon for production of the curli cluster proteins. false false _1197_ 0 6891 9 Not in stock false The intention is for production of this protein to amplify expression of the curli cluster. Detailed design required consideration of the interactions of downstream proteins of EnvZ (its regulation of OmpR and subsequent modulation of a number of downstream transcriptional activities). This protein acts in a single-input module network motif. false Sean Kearney annotation2210123 1 EnvZ range2210123 1 1 720 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K932000 1 BBa_K932000 OmpR234 under Tet Repressible Promoter 2012-09-15T11:00:00Z 2015-05-08T01:13:47Z Comes from the E. coli K-12 genome. This part promotes the constitutive expression of the curli cluster (csgD), proteins involved in cell-cell adhesion. false false _1197_ 0 6891 9 It's complicated false This part regulates curli expression within the cell via transcriptional activation. The construct can be repressed in the presence of the TetR repressor. false Sean Kearney component2210124 1 BBa_R0040 component2210137 1 BBa_B0015 component2210130 1 BBa_K932001 annotation2210130 1 BBa_K932001 range2210130 1 61 780 annotation2210124 1 BBa_R0040 range2210124 1 1 54 annotation2210137 1 BBa_B0015 range2210137 1 789 917 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K932000_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagatgcaagagaactacaagattctggtggtcgatgacgacatgcgcctgcgtgcgctgctggaacgttatctcaccgaacaaggcttccaggttcgaagcgtcgctaatgcagaacagatggatcgcctgctgactcgtgaatctttccatcttatggtactggatttaatgttacctggtgaagatggcttgtcgatttgccgacgtcttcgtagtcagagcaacccgatgccgatcattatggtgacggcgaaaggggaagaagtggaccgtatcgtaggcctggagattggcgctgacgactacattccaaaaccgtttaacccgcgtgaactgctggcccgtatccgtgcggtgctgcgtcgtcaggcgaacgaactgccaggcgcaccgtcacaggaagaggcggtaattgctttcggtaagttcaaacttaacctcggtacgcgcgaaatgttccgcgaagacgagccgatgccgctcaccagcggtgagtttgcggtactgaaggcactggtcagccatccgcgtgagccgctctcccgcgataagctgatgaaccttgcccgtggtcgtgaatattccgcaatggaacgctccatcgacgtgcagatttcgcgtctgcgccgcatggtggaagaagatccagcgcatccgcgttacattcagaccgtctggggtctgggctacgtctttgtaccggacggctctaaagcatgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K932001_sequence 1 atgcaagagaactacaagattctggtggtcgatgacgacatgcgcctgcgtgcgctgctggaacgttatctcaccgaacaaggcttccaggttcgaagcgtcgctaatgcagaacagatggatcgcctgctgactcgtgaatctttccatcttatggtactggatttaatgttacctggtgaagatggcttgtcgatttgccgacgtcttcgtagtcagagcaacccgatgccgatcattatggtgacggcgaaaggggaagaagtggaccgtatcgtaggcctggagattggcgctgacgactacattccaaaaccgtttaacccgcgtgaactgctggcccgtatccgtgcggtgctgcgtcgtcaggcgaacgaactgccaggcgcaccgtcacaggaagaggcggtaattgctttcggtaagttcaaacttaacctcggtacgcgcgaaatgttccgcgaagacgagccgatgccgctcaccagcggtgagtttgcggtactgaaggcactggtcagccatccgcgtgagccgctctcccgcgataagctgatgaaccttgcccgtggtcgtgaatattccgcaatggaacgctccatcgacgtgcagatttcgcgtctgcgccgcatggtggaagaagatccagcgcatccgcgttacattcagaccgtctggggtctgggctacgtctttgtaccggacggctctaaagcatga BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z