BBa_K933001 1 BBa_K933001 leader sequence with threonine repeats. mCherry and GFP reporters 2012-09-30T11:00:00Z 2015-05-08T01:13:47Z This piece was already partially assembled by a Ph.D student working in the Richard lab at Penn State named Mike Speer. Additional work was performed to perfect the construct with an alternate RBS from the registry. Repeat sequences were ordered as ssDNA oligos. This part tests codon optimization of the theonine codons. It is prefaced by an AHL leader sequence, then a 6-codon repeat sequence of one codon, followed by an mCherry and GFP reporter. The reporters determine the amount of tRNA degradation which occurs as a result of the repeat sequence. Use to determine other codon optimization characterization. false false _1198_ 0 13034 9 It's complicated false The original RBS in this plasmid construct was discarded in favor of a weaker translation RBS for mCherry. false Hannah Jepsen-Burger BBa_K933001_sequence 1 aggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctggaattcgcggccgcttctagagttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatgactataatgataaaaaaatcggattttttggcaattccatcggagggatccactactactactactactaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z