BBa_K936012 1 BBa_K936012 Leader sequence that brings protein to periplasm 2012-07-23T11:00:00Z 2015-05-08T01:13:47Z Artificial sequence Released HQ 2013 PelB is a sequence of amino acids that when attached to a protein coding sequence allows the cell to bring the protein to the periplasm of the cell. In our project pelB is being used in order to allow our cutinase enzyme to be brought to the periplasm of the cell. The ultimate goal for this sequence is to aid the cell in secreting our protein into the media in order to show degradation of PET. Our method of getting the enzyme to a high level of secretion is to overproduce it in the cell using the pelB sequence to bring the protein to the periplasm allowing for secretion. true false _1201_ 0 13899 9 Discontinued false Adding the pelB sequence in front of our protein coding sequence in order to make a pelB-LC-Cutinase construct. false Mattan Hamou BBa_J32015 1 PelB PelB leader sequence; directs protein to E. coli periplasmic membrane 2006-08-24T11:00:00Z 2015-08-31T04:08:46Z Novagen Released HQ 2013 The pelB leader sequence is a sequence of amino acids which when attached to a protein, directs the protein to the periplasmic membrane of E. coli, where the sequence is removed by pelB peptidase. It is used to direct coat protein-antigen fusions to the cell surface. false true _50_ 0 495 50 In stock true . true Austen Heinz annotation1898182 1 PelB range1898182 1 1 66 BBa_J32015_sequence 1 atgaaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgcccagccggcgatggcc BBa_K936012_sequence 1 atgaaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgcccagccggcgatggcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z