BBa_K940000 1 BBa_K940000 ALDH1A1 promoter in a pSB1C3 backbone 2012-09-24T11:00:00Z 2015-05-08T01:13:48Z Genomic sequence of Homosapiens. This part is a promoter for ALDH1A1,an enzyme involved in alcohol metabolism. Nucleotide sequences were analysed on NCBI. Sequences were selected by determining the start of the protein coding region and then taking the previous 1000 bases which included the TAATAA box. The sequences selected were compared with commercial sequences. Additionally overlap between the selected sequence and sequences on the Eukaryotic Promoter database (EPD) was confirmed. ALDH sequence was selected to exclude BioBrick restriction sites. false false _1207_ 0 14347 9 It's complicated false The sequence identified did not have any illegal sites, thus the primers were designed so as to have the sequence flanked with biobrick prefix and suffix. false Louise Usher BBa_K940000_sequence 1 gggcctttcttccccaaacagcaccttgattttctgggagatggactgatttcctgaaagccttgtcctgaagacacctggccagcttctactgagaacaagtgcccttttagactcttttcaatcctcaaattctctgattccaagtctgtcagagaacagaaagttacatagtagcattaaaaagcatgagaagtcaaaaaaataataactggccttagtggccagagcagctgctgcatacacttatcacaggtttcggctttgtaaattaattcatctgcaaatagtgcactgtctccaggtacaaattcgatgctggagcactggtttcttaaggatttaagtttaaagtcaaaggcttcctgccctaggtgttacaaataagtagtgtcgttttctttttttgctctgagtttgttcatccaatcgtatccgagtatgcaaataaactttagcccgtgcagataaaaaaggaacaaataaagccaagtgctctatcagaaccaaattgctgagccagtcacctgtgttccaggagccgaatcagaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z