BBa_K942000 1 BBa_K942000 SS+antiHis+Etag 2012-09-25T11:00:00Z 2015-05-08T01:13:48Z This part is a single chain variable fragment (scFv), this is a fusion of the variable domains of antibodies, its domains come from a murine anti body. This part is a single chain variable fragment (scFv), this is a fusion of the variable domains of antibodies. The antigen this scFv binds to with a greater stability is a C-terminal 6xHis tag; nevertheless it binds to tags with as less as 3xHis. It is formed by two domains, the variable heavy chain domain (VH) and the variable light chain domain (VL) (Kaufmann, Lindner, & Honegger, 2002). This protein has an estimated weight of 27.4kDa. It binds with the strongest force to C-terminal 6x His tag, but binds also to other types of His tags with different binding strength. The E-tag at the C-terminal for purification was not used in the end, instead an ultrafiltration with a 10kDa MWCO membrane was used. (Gasteiger E., 2005) About Safety The part itself does not present any biohazard characteristic, but it is important to remember that it is designed to work in Pichia pastoris and that a biosecurity chamber is recommended to handle this organism. Its secretion to the media should not suppose any problem. true false _1209_ 0 13053 9 Discontinued false This part is codon-optimized to be expressed in yeast. It is flanked by a secretion signal (SS) from the α-mating factor pre-sequence which makes the protein secretable by the yeast. An Etag was added at the C-terminal for affinity purification by L protein. This protein can be combined in fusion with another by a linker (GGGGS)4 in the C-terminal. false Luis Mario Leal Garza annotation2201788 1 BBa_K942001 range2201788 1 1 741 BBa_K942001 1 BBa_K942001 scFv anti-His 2012-09-25T11:00:00Z 2015-05-08T01:13:48Z As a fusion protein, the DNA of this scFv was synthetized artificially, its parts comes from a murine antibody. This part is a single chain variable fragment (scFv), this is a fusion of the variable domains of antibodies. The antigen this scFv binds to with a greater stability is a C-terminal 6xHis tag; nevertheless it binds to tags with as less as 3xHis. It is formed by two domains, the variable heavy chain domain (VH) and the variable light chain domain (VL). About safety The part itself does not present any biohazard characteristic, but it is important to remember that it is designed to work in Pichia pastoris and that a biosecurity chamber is recommended to handle this organism, false true _1209_ 0 13053 9 It's complicated false This part is codon-optimized to be expressed in yeast. It is composed by two domains fused by a (GGGS)4 linker. false Luis Mario Leal Garza BBa_K942001_sequence 1 gacattttgatgacacaaaccccaagttctttgccagtctctttaggtgaccaagctagtatctcttgtagatcttcacaatctatcgttcattcaaacggtaacacttatttggaatggtacttacaaaaaccaggtcaatcacctaagttgttgatctataaggtatccaacagattttctggtgtcccagatagattctcaggttccggtagtggtactgactttacattgaagatctcaagagttgaagcagaagatttgggtgtatattactgtttccaaggtagtcacgttccttttaccttcggttctggtactaaattggaaattaagagaggtggtggtggtagcggtggtggtggttctggtggtggtggttcaggtggtggtggttcccaagttcaattacaacaatctggtccagaagacgtcaaacctggtgcctctgttaaaatatcatgcaaggcttccggttacacctttactgattactacatgaactgggtaaagcaatcacctggtaaaggtttggaatggattggtgacataaatcctaataacggtggtacttcctataaccaaaaattcaagggtagagcaacattaaccgtagataaatccagttctacagcctacatggaattgagatccttaaccagtgaagactcatccgtctattactgcgaatctcaatcaggtgcttattggggtcaaggtactacagttacagtatcagct BBa_K942000_sequence 1 gacattttgatgacacaaaccccaagttctttgccagtctctttaggtgaccaagctagtatctcttgtagatcttcacaatctatcgttcattcaaacggtaacacttatttggaatggtacttacaaaaaccaggtcaatcacctaagttgttgatctataaggtatccaacagattttctggtgtcccagatagattctcaggttccggtagtggtactgactttacattgaagatctcaagagttgaagcagaagatttgggtgtatattactgtttccaaggtagtcacgttccttttaccttcggttctggtactaaattggaaattaagagaggtggtggtggtagcggtggtggtggttctggtggtggtggttcaggtggtggtggttcccaagttcaattacaacaatctggtccagaagacgtcaaacctggtgcctctgttaaaatatcatgcaaggcttccggttacacctttactgattactacatgaactgggtaaagcaatcacctggtaaaggtttggaatggattggtgacataaatcctaataacggtggtacttcctataaccaaaaattcaagggtagagcaacattaaccgtagataaatccagttctacagcctacatggaattgagatccttaaccagtgaagactcatccgtctattactgcgaatctcaatcaggtgcttattggggtcaaggtactacagttacagtatcagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z