BBa_K942018 1 BBa_K942018 Shuttle Sequence (SS+B.P.S.) 2012-09-25T11:00:00Z 2015-05-08T01:13:48Z This part is a mix from the SS of α-mating factor pre-sequence and a consensus non-translational yeast mRNA sequence. Using this part after the 3??? of a yeast promoter and before the 5??? of any CDS, the user can make a single construct that can yield protein expression in both, E.coli (DE3 strains) and yeast. In our case we used the AOX1 promoter and the CDS for Der f 2 for expression in BL21 STAR, Rossettagami and P.pastoris. About safety This part presents no biosecurity issues apart that any construct after the 3??? of this part could be expressed both in yeast and in bacteria. false true _1209_ 0 13053 9 It's complicated false Encrypted in non-translatable sequence after the SS, the T7 promoter (BBa_I712074) and a RBS promote the bacterial expression of the protein. This last feature lets the user transform the same construct for bacterial intracellular expression and extracellular yeast expression. Use this part after the 3??? of a yeast promoter and before the 5??? of any CDS. false Luis Mario Leal Garza BBa_K942003 1 BBa_K942003 SS+B.P.S. 2012-09-25T11:00:00Z 2015-05-08T01:13:48Z This part is a mix from the SS of α-mating factor pre-sequence and a consensus non-translational yeast mRNA sequence. Using this part after the 3??? of a yeast promoter and before the 5??? of any CDS, the user can make a single construct that can yield protein expression in both, E.coli (DE3 strains) and yeast. In our case we used the AOX1 promoter and the CDS for Der f 2 for expression in BL21 STAR, Rossettagami and P.pastoris. About Safety This part presents no biosecurity issues apart that any construct after the 3??? of this part could be expressed both in yeast and in bacteria. true false _1209_ 0 13053 9 Discontinued false Encrypted in non-translatable sequence after the SS, the T7 promoter (BBa_I712074) and a RBS promote the bacterial expression of the protein. This last feature lets the user transform the same construct for bacterial intracellular expression and extracellular yeast expression. Use this part after the 3??? of a yeast promoter and before the 5??? of any CDS. false Luis Mario Leal Garza BBa_K942018_sequence 1 atgagatttccttccattttcacagccgttttattcgcagcatcctccgcattggcagtatgttaatagtaatacgactcactatagggaatacaagctacttgttctttttgcattactaacgacaaggaggttatag BBa_K942003_sequence 1 atgagatttccttccattttcacagccgttttattcgcagcatcctccgcattggcagtatgttaatagtaatacgactcactatagggaatacaagctacttgttctttttgcattactaacgacaaggaggttatag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z