BBa_K942004 1 BBa_K942004 Shuttle Sequence (SS+B.P.S.)+Der f 2+His 2012-09-25T11:00:00Z 2015-05-08T01:13:48Z This part is a mix from the SS of α-mating factor pre-sequence, Der f 2 allergen from Dermatophagoides farinae, and a consensus non-translational yeast mRNA sequence. (Uniprot:Q5TIW0) Der f 2 is a major allergen from Dermatophagoides farinae, although its biological function in the dust mite has not been well discovered yet. It comes flanked with the α-mating factor pre-sequence for protein secretion. This protein has an estimated weight of 16.6kDa. It has a folding similar to that of an immunoglobulin and also has a suspected antibacterial activity, yet it has been expressed previously in E.coli. We recommend its affinity purification using the 6x His tag. (Liu Z, 2007) About Safety The Der f 2 protein is a major allergen from the dust mite, so any contact with cells transformed with this part should be done with appropriate gloves. Also we recommend that the use must make sure he/she is not allergic to dust mite. The secretion of this protein makes this part more hazardous so you would like to have extra precaution to prevent any leak from your samples. false false _1209_ 0 13053 9 It's complicated false This composite part has a secretion signal (SS) for an easier purification, maxed out using affinity purification with the C-terminal 6x His tag. As the SS is functional only in yeast, the codon optimization for this sequence was done for a yeast-like codon bias. Also, encrypted in non-translatable sequence after the SS, the T7 promoter (BBa_I712074) and a RBS promote the bacterial expression of the protein. This last feature lets the user transform the same construct for bacterial intracellular expression and extracellular yeast expression. false Luis Mario Leal Garza BBa_K942004_sequence 1 atgagatttccttccattttcacagccgttttattcgcagcatcctccgcattggcagtatgttaatagtaatacgactcactatagggaatacaagctacttgttctttttgcattactaacgacaaggaggttatagatgatttctaagattttatgtttgagtttgttggttgccgcagttgttgccgaccaagttgatgttaaggattgtgctaataacgaaattaaaaaggttatggtagacggttgtcatggttctgatccatgcattatacacagaggtaaaccttttacattggaagctttattcgatgcaaaccaaaacactaagacagccaagatcgaaattaaggcttcattggatggtttagaaatagacgttccaggtatcgataccaatgcatgtcattttatgaaatgccctttggtaaagggtcaacaatacgacatcaagtacacctggaacgttccaaagatcgctcctaagtccgaaaacgttgtagtcactgtcaagttaattggtgacaacggtgttttagcctgtgccatagcaactcacggtaaaatcagagaccaccaccatcatcatcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z