BBa_K942007 1 BBa_K942007 SS+Api m 6+His 2012-09-25T11:00:00Z 2015-05-08T01:13:48Z The Api m 6 allergen native from Apis miellifera, is an allergen from the bee venom. The Api m 6 allergen native from Apis miellifera, is an allergen from the bee venom. Not only it acts as an allergen but it also contains a Trypsin-Inhibitor Domain. The secretion signal (SS) from α-mating factor pre-sequence is included for this construct also for extracellular secretion. (Peiren N., 2006) This allergen has a molecular weight of 8.4kDa and is better visualized in a SDS-PAGE with Tris-Tricine gel buffer, because of its low molecular weight. It can be purified by affinity with its 6xHis tag. (Gasteiger E., 2005) Safety The Api m 6 protein is an allergen from the bee venom, so any contact with cells transformed with this part should be done with appropriate gloves. Also we recommend that the use must make sure he/she is not allergic to bee venom. The secretion of this protein makes this part more hazardous so you would like to have extra precaution to prevent any leak from your samples. false false _1209_ 0 13053 9 It's complicated false The SS at the N-terminal of this protein is useful for extracellular secretion. Its purification can be done by affinity to metallic ions with 6x His tag. Api m 6 codon optimization is done to be better expressed in yeasts. false Luis Mario Leal Garza BBa_K942007_sequence 1 atgagatttccttccattttcacagccgttttattcgcagcatcctccgcattggcattcggtggtttcggtggtttcggtggtttaggtggtcgtggtaaatgtccatctaacgaaatttttagtagatgtgatggtagatgccaaagattctgtccaaacgttgtaccaaagcctttgtgcattaaaatatgtgctcctggttgtgtatgcagattgggttatttgagaaataagaagaaagtctgcgttcctagatccaaatgtggtcatcaccatcaccatcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z