BBa_K942009 1 BBa_K942009 SS+ Zea m 14+His 2012-09-25T11:00:00Z 2015-05-08T01:13:48Z In its native organism, Zea mays, Zea m 14 works as a lipid-transfer protein. It is known for causing allergenic response in humans. In its native organism, Zea mays, Zea m 14 works as a lipid-transfer protein. It is known for causing allergenic response in humans. The secretion signal (SS) from α-mating factor pre-sequence is included for this construct also for extracellular secretion. (Gomar J., 1996) This protein has an estimated molecular weight of 9.8 kDa and is better visualized in a SDS-PAGE with Tris-Tricine gel buffer, because of its low molecular weight (Gasteiger E., 2005). It can be purified easily by affinity purification taking advantage of the 6xHis tag properties. About Safety The Zea m 14 protein is a major food allergen from the maize, so any contact with cells transformed with this part should be done with appropriate gloves. Also we recommend that the use must make sure he/she is not allergic to maize. The secretion of this protein makes this part more hazardous so you would like to have extra precaution to prevent any leak from your samples false false _1209_ 0 13053 9 It's complicated false The SS at the N-terminal of this protein is useful for extracellular secretion. Its purification can be done by affinity to metallic ions with 6x His tag. Zea m 14 codon optimization is done to be better expressed in yeasts. false Luis Mario Leal Garza BBa_K942009_sequence 1 atgagatttccatccatttttaccgcagtattattcgccgcttccagtgcattagcagccatttcctgtggtcaagtagcatcagcaattgctccatgtatatcctatgcaagaggtcaaggttccggtcctagtgccggttgttgctccggtgtcagaagtttgaataacgctgcaagaactacagctgatagaagagccgcttgtaattgcttgaaaaacgcagccgctggtgtttctggtttaaatgctggtaacgcagcctctataccatcaaagtgtggtgtttctatcccttacacaatttctacctcaactgactgctcaagagtaaatcatcaccatcaccatcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z