BBa_K942010 1 BBa_K942010 Zea m 14 2012-09-25T11:00:00Z 2015-05-08T01:13:48Z The Zea m 14 allergen native from Zea mays is a common food allergen. The Zea m 14 allergen native from Zea mays is a common food allergen. Not only it acts as an allergen but it also works as a lipid-transfer protein. It is known for causing allergenic response in humans. About Safety The Zea m 14 protein is a major food allergen from the maize, so any contact with cells transformed with this part should be done with appropriate gloves. Also we recommend that the use must make sure he/she is not allergic to maize. false false _1209_ 0 13053 9 It's complicated false Zea m 14 codon optimization is done to be better expressed in yeasts. false Luis Mario Leal Garza BBa_K942010_sequence 1 gccatttcctgtggtcaagtagcatcagcaattgctccatgtatatcctatgcaagaggtcaaggttccggtcctagtgccggttgttgctccggtgtcagaagtttgaataacgctgcaagaactacagctgatagaagagccgcttgtaattgcttgaaaaacgcagccgctggtgtttctggtttaaatgctggtaacgcagcctctataccatcaaagtgtggtgtttctatcccttacacaatttctacctcaactgactgctcaagagtaaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z