BBa_K942011 1 BBa_K942011 RiAFP+His 2012-09-25T11:00:00Z 2016-01-27T10:45:02Z Is produced natively in the beetle Raghium inquisitor. (Kristiansen E, 2011) The Raghium inquisitor Anti Freeze Protein (RiAFP) is a 137 AA protein that prevents the growth of ice crystals. This protein is produced natively in the beetle Raghium inquisitor. (Kristiansen E, 2011) About Safety The RiAFP has no reported toxicity or hazardousness, but its important to remember to have the basic biosafety precautions using a biosecurity chamber when handling any transformed strains. false false _1209_ 4206 13053 9 It's complicated false This part was designed by adding a 6xHis tag for affinity purification to the anti freeze protein from Raghium inquisitor. This part was codon optimized for its expression in E.coli. false Luis Mario Leal Garza BBa_K942011_sequence 1 atgtactcgtgccgcgcagttggtgtcgacggtcgtgcagttacggacattcagggtacctgtcatgctaaggctacgggtgccggtgcgatggcctctggcaccagtgaaccgggttccacctcaacggcaaccgctacgggtcgtggtgcaaccgcacgttcgaccagcacgggccgtggtaccgcgaccacgaccgccaccggcacggcatccgctacctcaaacgcgattggccagggtaccgcaacgaccacggctacgggctcggcgggcggtcgcgccaccggtagcgcaaccacgagctctagtgcttctcagccgacccagacgcaaaccatcacgggcccgggttttcaaaccgccaaatcattcgcacgcaacaccgcaaccacgaccgttaccgcatcgcaccatcatcaccatcactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z