BBa_K942020 1 BBa_K942020 RiAFP 2012-09-25T11:00:00Z 2015-05-08T01:13:48Z Is produced natively in the beetle Raghium inquisitor. (Kristiansen E, 2011) Raghium inquisitor Anti Freeze Protein (RiAFP) is a 137 AA protein that prevents the growth of ice crystals. This protein is produced natively in the beetle Raghium inquisitor. (Kristiansen E, 2011) About Safety The RiAFP has no reported toxicity or hazardousness, but it???s important to remember to have the basic biosafety precautions using a biosecurity chamber when handling any transformed strains. false true _1209_ 0 13053 9 It's complicated false This part was codon optimized for its expression in E.coli. false Luis Mario Leal Garza BBa_K942020_sequence 1 atgtactcctgtcgtgcagtcggcgtggatggccgtgcagttaccgacattcagggcacgtgccatgcgaaagcaaccggtgcaggtgctatggcatctggtaccagtgaaccgggttccacctcaacggcaaccgcaacgggtcgtggtgctaccgcgcgctcgaccagcacgggtcgtggtaccgctaccacgaccgcaaccggtacggcatccgcaacctcaaacgccattggccaaggtaccgccacgaccacggcaacgggctcggctggcggtcgcgcgaccggtagcgccaccacgagctctagtgcatctcagccgacccagacgcaaaccatcacgggcccgggttttcaaaccgctaagtcattcgcacgcaatacggcaacgacgacggttacggcatcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z