BBa_K944000 1 BBa_K944000 Putative Promoter Induced by Cyanide Compounds 2012-09-24T11:00:00Z 2015-05-08T01:13:48Z This part came from the genomic sequence Pseudomonas pseudoalcaligenes CECT5344 and was synthesized by IDT technologies. This part works with the transcriptional regulator of the Cyanide operon from Pseudomonas pseudoalcaligenes CECT5344.It is negatively regulated by ammonium and positively regulated by cyanate, cyanide, and some cyanometallic complexes. false false _1211_ 0 7118 9 It's complicated false This promoter is known to be in the cyanase operon from Pseudomonas pseudoalcaligenes CECT5344 between the cynF which is the transcriptional regulator and CynA, but its specific sequence is unknown, so our team use the sequence between this two genes to be sure that we get our inducible promoter. false Natasha G??mez BBa_K944000_sequence 1 tcgtgatcactcctgcgatggcctgccccaaattggtgaggcgggcgctgactgggctgggccattgctgaccggttcatgtcagctattgcaggagctgtaccagttcaaaaatctatataagcgattgaaaaatataaacttttaacaaaaccaataaatacgaaatctcgttattcacgagatttcgtcatcttgaaaaacgagatatcgtcaactggcacgccctttggataacgtcctgaaaggtcaatcccgagagcgccgcaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z