BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K944005 1 BBa_K944005 Putative promoter induced by cyanide and cyande complexes with RBS 2012-09-25T11:00:00Z 2015-05-08T01:13:48Z This part came from the genomic sequence Pseudomonas pseudoalcaligenes CECT5344 and was synthesized by IDT technologies. This Biobrick part is an intermediate construct wich have the cyanide and cyanide complexes inducible promoter and a well characterized RBS used extensively by iGEMers. false true _1211_ 0 7118 9 Not in stock false There is not a detailed sequence for the inducible promoter but it is known to be in between of the sequence. false Natasha G??mez component2202310 1 BBa_K944000 component2202312 1 BBa_B0034 annotation2202312 1 BBa_B0034 range2202312 1 279 290 annotation2202310 1 BBa_K944000 range2202310 1 1 270 BBa_K944000 1 BBa_K944000 Putative Promoter Induced by Cyanide Compounds 2012-09-24T11:00:00Z 2015-05-08T01:13:48Z This part came from the genomic sequence Pseudomonas pseudoalcaligenes CECT5344 and was synthesized by IDT technologies. This part works with the transcriptional regulator of the Cyanide operon from Pseudomonas pseudoalcaligenes CECT5344.It is negatively regulated by ammonium and positively regulated by cyanate, cyanide, and some cyanometallic complexes. false false _1211_ 0 7118 9 It's complicated false This promoter is known to be in the cyanase operon from Pseudomonas pseudoalcaligenes CECT5344 between the cynF which is the transcriptional regulator and CynA, but its specific sequence is unknown, so our team use the sequence between this two genes to be sure that we get our inducible promoter. false Natasha G??mez BBa_K944005_sequence 1 tcgtgatcactcctgcgatggcctgccccaaattggtgaggcgggcgctgactgggctgggccattgctgaccggttcatgtcagctattgcaggagctgtaccagttcaaaaatctatataagcgattgaaaaatataaacttttaacaaaaccaataaatacgaaatctcgttattcacgagatttcgtcatcttgaaaaacgagatatcgtcaactggcacgccctttggataacgtcctgaaaggtcaatcccgagagcgccgcaatactagagaaagaggagaaa BBa_B0034_sequence 1 aaagaggagaaa BBa_K944000_sequence 1 tcgtgatcactcctgcgatggcctgccccaaattggtgaggcgggcgctgactgggctgggccattgctgaccggttcatgtcagctattgcaggagctgtaccagttcaaaaatctatataagcgattgaaaaatataaacttttaacaaaaccaataaatacgaaatctcgttattcacgagatttcgtcatcttgaaaaacgagatatcgtcaactggcacgccctttggataacgtcctgaaaggtcaatcccgagagcgccgcaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z