BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K944005 1 BBa_K944005 Putative promoter induced by cyanide and cyande complexes with RBS 2012-09-25T11:00:00Z 2015-05-08T01:13:48Z This part came from the genomic sequence Pseudomonas pseudoalcaligenes CECT5344 and was synthesized by IDT technologies. This Biobrick part is an intermediate construct wich have the cyanide and cyanide complexes inducible promoter and a well characterized RBS used extensively by iGEMers. false true _1211_ 0 7118 9 Not in stock false There is not a detailed sequence for the inducible promoter but it is known to be in between of the sequence. false Natasha G??mez component2202312 1 BBa_B0034 component2202310 1 BBa_K944000 annotation2202312 1 BBa_B0034 range2202312 1 279 290 annotation2202310 1 BBa_K944000 range2202310 1 1 270 BBa_K944014 1 BBa_K944014 Cyanide Biosensor expression platform using a cyanide inducible promoter 2012-09-25T11:00:00Z 2015-05-08T01:13:48Z The cyanideinducible promoter come from Pseudomonas pseudoalcaligenes and the other genes are well characterized biobribricks from the registry. This is another expression platform for another of our brand new biobricks. It will express a Red Fluorescent Protein in the presence of cyanide and cyanide compounds in the environment. false false _1211_ 0 7118 9 Not in stock false We are working very hard with this construct for further characterization. false Natasha G??mez component2259746 1 BBa_K944007 component2259735 1 BBa_K944005 annotation2259735 1 BBa_K944005 range2259735 1 1 290 annotation2259746 1 BBa_K944007 range2259746 1 297 1139 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K944000 1 BBa_K944000 Putative Promoter Induced by Cyanide Compounds 2012-09-24T11:00:00Z 2015-05-08T01:13:48Z This part came from the genomic sequence Pseudomonas pseudoalcaligenes CECT5344 and was synthesized by IDT technologies. This part works with the transcriptional regulator of the Cyanide operon from Pseudomonas pseudoalcaligenes CECT5344.It is negatively regulated by ammonium and positively regulated by cyanate, cyanide, and some cyanometallic complexes. false false _1211_ 0 7118 9 It's complicated false This promoter is known to be in the cyanase operon from Pseudomonas pseudoalcaligenes CECT5344 between the cynF which is the transcriptional regulator and CynA, but its specific sequence is unknown, so our team use the sequence between this two genes to be sure that we get our inducible promoter. false Natasha G??mez BBa_K944007 1 BBa_K944007 Higly engineered mutant of RFP and a double terminator 2012-09-25T11:00:00Z 2015-05-08T01:13:48Z This is the ligation of two existing biobricks from the registry. Released HQ 2013 For more information about this two parts please visit the page of the BioBricks BBa_E1010 for RFP and BBa_B0015 for the double terminator. false false _1211_ 0 7118 9 In stock false No considerations right now. false Natasha G??mez component2248230 1 BBa_E1010 component2248237 1 BBa_B0015 annotation2248230 1 BBa_E1010 range2248230 1 1 706 annotation2248237 1 BBa_B0015 range2248237 1 715 843 BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation2214014 1 Help:Barcodes range2214014 1 682 706 annotation1014044 1 mrfp1 range1014044 1 1 675 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K944005_sequence 1 tcgtgatcactcctgcgatggcctgccccaaattggtgaggcgggcgctgactgggctgggccattgctgaccggttcatgtcagctattgcaggagctgtaccagttcaaaaatctatataagcgattgaaaaatataaacttttaacaaaaccaataaatacgaaatctcgttattcacgagatttcgtcatcttgaaaaacgagatatcgtcaactggcacgccctttggataacgtcctgaaaggtcaatcccgagagcgccgcaatactagagaaagaggagaaa BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K944014_sequence 1 tcgtgatcactcctgcgatggcctgccccaaattggtgaggcgggcgctgactgggctgggccattgctgaccggttcatgtcagctattgcaggagctgtaccagttcaaaaatctatataagcgattgaaaaatataaacttttaacaaaaccaataaatacgaaatctcgttattcacgagatttcgtcatcttgaaaaacgagatatcgtcaactggcacgccctttggataacgtcctgaaaggtcaatcccgagagcgccgcaatactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_K944000_sequence 1 tcgtgatcactcctgcgatggcctgccccaaattggtgaggcgggcgctgactgggctgggccattgctgaccggttcatgtcagctattgcaggagctgtaccagttcaaaaatctatataagcgattgaaaaatataaacttttaacaaaaccaataaatacgaaatctcgttattcacgagatttcgtcatcttgaaaaacgagatatcgtcaactggcacgccctttggataacgtcctgaaaggtcaatcccgagagcgccgcaa BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_K944007_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z