BBa_K987001 1 BBa_K987001 This is a composite part which has the function to invert the temperature activation by the part: BB 2013-06-20T11:00:00Z 2015-05-08T01:13:50Z It is a combinatio of two parts, they work in order to reverse some kinds of riboswitches This part reverses some kinds of riboswitches false false _1284_ 0 15313 9 Not in stock false It works with different riboswitches but it can't work with other ones, there is no list of the ribositches at which it can work and it can't work. false Daniel Gerardo Rodr??guez Reyna component2330160 1 BBa_J23100 component2330162 1 BBa_K115017 annotation2330160 1 BBa_J23100 range2330160 1 1 35 annotation2330162 1 BBa_K115017 range2330162 1 44 126 BBa_K115017 1 BBa_K115017 RNA thermometer (ROSE 32??C) 2008-08-19T11:00:00Z 2015-05-08T01:09:28Z Based on ROSE RNA thermometer sequences from Rfam database. Released HQ 2013 An RNA thermometer that theoretically switches on translation at 32 degrees Celcius and switched of translation below that temperature. Still to be tested. false false _223_ 0 3006 9 In stock true a lot, will be added soon. true Bastiaan van den Berg annotation1972920 1 SD range1972920 1 77 82 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_K115017_sequence 1 ccgggcgcccttcgggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtccagtctttgctcagtggaggat BBa_K987001_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagccgggcgcccttcgggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtccagtctttgctcagtggaggat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z