BBa_K988002 1 BBa_K988002 Oxytocin-Neurophysin1 2013-06-20T11:00:00Z 2015-05-08T01:13:50Z This Part was developed from the Homosapien sapien coding sequence for Oxytocin-Neurophysin1 This Part was developed from the Homosapien sapien (human) coding sequence for Oxytocin-Neurophysin1(1) the original signal sequence was replaced with a new (PelB) signal sequence (2) to send the protein to periplasmic space on and then be cleaved the 5' end this also allows for potential increased stability of the folded protein. A 6x-His tag was added for purification on the 3' end. (1)http://www.uniprot.org/uniprot/P01178 (2)http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2259416/ (3)http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0063442 false false _1285_ 0 12948 9 It's complicated false The part was back translated from the protein sequence to ensure the right DNA sequence was obtained for the proper protein sequence. When adding the PelB signal sequence it was was very important to consider the cleavage site as the C-C disulfide bond was necessary to be translated, without a signal sequence the protein would have to start with a Methionine, with would disrupt the C-C disulfide bond. the His tag was added to help with with protein Purification. false Isaac Ward annotation2329967 1 Signal Sequence range2329967 1 2 67 annotation2329992 1 6x Histidine tag & stop codon range2329992 1 386 406 annotation2329990 1 Oxytocin range2329990 1 68 95 annotation2329991 1 Neurophysin 1 range2329991 1 96 386 BBa_K988002_sequence 1 tatgaaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgcccagccggcgatggcctgctacatccagaactgcccgctgggtggtaaacgtgctgctccggacctggacgttcgtaaatgcctgccgtgcggtccgggtggtaaaggtcgttgcttcggtccgaacatctgctgcgctgaagaactgggttgcttcgttggtaccgctgaagctctgcgttgccaggaagaaaactacctgccgtctccgtgccagtctggtcagaaagcttgcggttctggtggtcgttgcgctgttctgggtctgtgctgctctccggacggttgccacgctgacccggcttgcgacgctgaagctaccttctctcagcgtcaccaccaccaccaccactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z