BBa_K993000 1 BBa_K993000 RFP Generator with ROSE thermometer 2013-06-13T11:00:00Z 2015-05-08T01:13:51Z Bradyrhizobium japonicum USDA 110 and Registry The repression of heat shock gene expression (ROSE) element is an RNA element found in the 5' UTR of some heat shock protein's mRNAs. The ROSE element is an RNA thermometer that negatively regulates heat shock gene expression. The secondary structure is thought to be altered by temperature, thus it is an RNA thermometer. This structure blocks access to the ribosome binding site at normal temperatures. During heat shock however, the structure changes freeing the ribosome binding site and allowing expression to occur. RNA Thermometers are the only known single-component regulators of gene expression.(1) RNA Thermometers are thermosensors that regulate gene expression by temperature-induced changes in RNA conformation. Naturally occurring RNA Thermometers exhibit complex secondary structures which are believed to undergo a series of gradual structural changes in response to temperature shifts.(2) RNA Thermometers often regulate genes required during either a heat shock or cold shock response, but have been implicated in other regulatory roles such as in pathogenecity and starvation.(3) false false _1290_ 0 11156 9 Not in stock false Note that RNA thermometer actually works as an RBS sequence. Therefore, this part does not include an additional ribosome binding site. Also, this part does not contain an terminator sequence, but a simple stop codon. The RFP should be translated continuously. false ABD??LKADİR KARADAĞ annotation2329453 1 pVeg2 range2329453 1 1 97 annotation2329455 1 RFP Generator range2329455 1 194 902 annotation2329457 1 Start Codon range2329457 1 194 196 annotation2329456 1 Finish Codon range2329456 1 900 902 annotation2329454 1 ROSE Thermometer range2329454 1 98 193 BBa_K993000_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttttttgacaaaaatgggctcgtgttgtacaataaatgtgccgcgacaagcggtccgggcgccctaggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtcaagttcttgctccttggaggatatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z