BBa_K993001 1 BBa_K993001 RFP Generator with ROSE thermometer 2013-06-06T11:00:00Z 2015-05-08T01:13:51Z Bradyrhizobium japonicum USDA 110 and Registry Repression of heat shock gene expression (ROSE) element is an RNA element found in the 5' UTR of some heat shock protein's mRNAs. The ROSE element is an RNA thermometer that negatively regulates heat shock gene expression. In this part, red fluorescent protein (RFP) is added in the downstream region to measure the activity of RNA thermometer. You check our Experience page for further information about our characterization and experiments. For the inner elements in the part design; check out the Part Design page. RNA Thermometers are the only known single-component regulators of gene expression.(1) RNA Thermometers are thermosensors that regulate gene expression by temperature-induced changes in RNA conformation. Naturally occurring RNA Thermometers exhibit complex secondary structures which are believed to undergo a series of gradual structural changes in response to temperature shifts.(2) RNA Thermometers often regulate genes required during either a heat shock or cold shock response, but have been implicated in other regulatory roles such as in pathogenecity and starvation.(3) true false _1290_ 0 9573 9 Discontinued false Note that RNA thermometer actually works as an RBS sequence. Therefore, this part does not include an additional ribosome binding site. Also, this part does not contain an terminator sequence, but a simple stop codon. The RFP should be translated continuously. false Mustafa Elitok BBa_K993001_sequence 1 gaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttttttgacaaaaatgggctcgtgttgtacaataaatgtgccgcgacaagcggtccgggcgccctaggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtcaagttcttgctccttggaggatatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z