BBa_K993002 1 BBa_K993002 IbpB RNA Thermometer with RFP 2013-06-13T11:00:00Z 2015-05-08T01:13:51Z Escherichia coli, NCBI GeneBank Other elements are obtained from Registry. The IbpB thermometer is an RNA thermometer element found in the ibpAB operon. The operon contains two heat-shock genes, encoding inclusion body binding proteins A and B (IbpA/B), and is the most drastically upregulated operon under heat-shock in Escherichia coli. IbpA is regulated by a ROSE element found in its 5' UTR, while IbpB has its own heat-sensitive cis-regulatory element. The activity of this thermoregulator was confirmed in vitro but was not found in vivo, suggesting more complicated operon regulation exists in bacterial cells. In this part, red fluorescent protein (RFP) is added in the downstream region to measure the activity of RNA thermometer. You check our Experience page for further information about our characterization and experiments. For the inner elements in the part design; check out the Part Design page. RNA Thermometers are the only known single-component regulators of gene expression.(1) RNA Thermometers are thermosensors that regulate gene expression by temperature-induced changes in RNA conformation. Naturally occurring RNA Thermometers exhibit complex secondary structures which are believed to undergo a series of gradual structural changes in response to temperature shifts.(2) RNA Thermometers often regulate genes required during either a heat shock or cold shock response, but have been implicated in other regulatory roles such as in pathogenecity and starvation.(3) false false _1290_ 0 11153 9 Not in stock true Note that RNA thermometer actually works as an RBS sequence. Therefore, this part does not include an additional ribosome binding site. Also, this part does not contain an terminator sequence, but a simple stop codon. The RFP should be translated continuously. false İBRAHİM YASİR ORHAN annotation2329445 1 Stop codon range2329445 1 915 917 annotation2329443 1 IbpB thermometer range2329443 1 98 208 annotation2329442 1 pVeg2 range2329442 1 1 97 annotation2329444 1 RFP range2329444 1 209 917 annotation2329446 1 Start codon range2329446 1 209 211 BBa_K993002_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttttttgacaaaaatgggctcgtgttgtacaataaatgtttccctaaggccgcctggcgcggcctgacatctccatgctcgccgtcagggagcatatgcgaatcttcggatttgcaggtacttactcgcttcttagaaggagaaatgactatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z