BBa_M0050 1 LAA AANDENYALAA. (Very fast) SsrA degradation tag. 2007-12-05T12:00:00Z 2015-05-08T01:13:51Z C-terminal degradation tags are commonly found in high turnover proteins in Escherichia coli. This sequence codes for the amino acid sequence AANDENYALAA, which when fused to the C-terminal of proteins, will make the protein susceptible to very fast degradation through SspB-mediated binding to the ClpX protease. The following rates of degradation of this tag are pulled from the corresponding references below: ~5 Vmax/ [Clpx6] min-1 from (1) ~0.5%/min on log scale from (2) ~1 min half life from (3) See the following references for further information on degradation rates and mechanisms of this tag: (1)McGinness, Baker, Sauer. 2006. Mol. Cell. 22:701. (2)Flynn et al 2003. Mol. Cell. 11: 671. Flynn et al. 2001. PNAS 98(19): 10584. Anderson et al 1998. App. Env. Microbiol. 64(6):2240. false false _11_ 0 2398 11 Not in stock false C-terminal tag. Degradation rate is very fast. Deviations from this sequence in key amino acids will lower degradation rates (see Parts BBa_M0051, BBa_M0052, BBa_M0053). Three C-terminal aa's (LAA in this case) are necessary and sufficient for ClpX binding and degradation. Upstream aa sequence serves as a binding site for SspB, which guides rapid binding to ClpX. false Felix Moser annotation1958880 1 WT SsrA tag AANDENYALAA range1958880 1 1 33 BBa_M0050_sequence 1 gctgctaacgacgaaaactacgctctggctgct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z