BBa_M10019 1 FLAG {&#706;FLAG&#707;} 2009-05-08T11:00:00Z 2015-05-08T01:13:51Z Wobble PCR Jw0019F / Jw0020R (45 bp, EcoRI/BamHI) <br> Sub into pBca1256 (EcoRI/BamHI, 2472+ 910, L) <br> Product is pBca1256-K112602 {Flag} <br> --------------------------------------------------- <br> Jw0019F Forward construction of Flag <br> cgataGAATTCatgAGATCTgactacaaggatgacgacg <br> Jw0020R Reverse construction of Flag <br> ccagtGGATCCcttgtcgtcgtcatccttgtagtc <br> Later false false _271_ 0 4737 271 It's complicated true Later false John Wang BBa_M10019_sequence 1 gactacaaggatgacgacgacaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z