BBa_M10043 1 BBa_M10043 {˂MagBead_BP˃} 2009-04-26T11:00:00Z 2015-05-08T01:13:51Z Wobble (overlapping oligos) This peptide sequence binds magnetic beads false false _271_ 0 4740 271 Not in stock true none false Simina Ticau BBa_M10043_sequence 1 caccacaaatactggcaccgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z