BBa_M10063 1 BBa_M10063 {CPompX!} 2009-05-09T11:00:00Z 2015-05-08T01:13:51Z PCR from genomic DNA Circularly permutated ompX. <br> Circular permutation re-orders the protein so that both termini are exposed to the extra-cellular environment. <br> CPompX is an outer membrane carrier protein that can be used to display other proteins on the outer membrane. "Display proteins" can be fused to the N-termini of {CPompX!} and should be functionally displayed on the outer membrane of E.coli. false false _271_ 0 4745 271 Not in stock false Followed designs from Bessette et al, 2004 (PMID: 15531628) false Jennifer Brophy BBa_M10063_sequence 1 ggtgactacaacaaaaaccagtactacggcatcactgctggtccggcttaccgcattaacgactgggcaagcatctacggtgtagtgggtgtgggttatggtaaattccagaccactgaatacccgacctacaaacacgacaccagcgactacggtttctcctacggtgcgggtctgcagttcaacccgatggaaaacgttgctctggacttctcttacgagcagagccgtattcgtagcgttgacgtaggcacctggattgccggtgttggttaccgcttcggaggaagcggagcgacttctactgtaactggcggttacgcacagagcgacgctcagggccaaatgaacaaaatgggcggtttcaacctgaaataccgctatgaagaagacaacagcccgctgggtgtgatcggttctttcacttacaccgagaaaagtcgtactgcaagctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z