BBa_M11006 1 BBa_M11006 ArsC arsenate reductase protein 2009-04-11T11:00:00Z 2015-05-08T01:13:52Z This particular form of ArsC was isolated from Escherichia coli strain CFT073. Sequence obtained from NCBI accession NP_756163. This gene, which composes part of the arsenic resistance system of several microorganisms, is responsible for the coding of an enzyme which reduces arsenate (ars(V) with a +5 oxidation state) to arsenite (ars(III) with a +3 oxidation state). This is an important step in cell recognition and binding of arsenic ions as most arsenic resistance proteins within microorganisms interact best with arsenite rather than arsenate. This gene could be useful in arsenic detection and binding experiments as it would allow all present arsenic to assume a single, more easily detectable/bindable form, recognizable by common arsenic binding proteins such as ArsR. false false _302_ 0 4567 302 Not in stock false The sequence of this gene was not altered in any way from the reference sequence given by NCBI accession number NP_756163. false Eric Monson annotation2002304 1 Start range2002304 1 1 3 BBa_M11006_sequence 1 atgagcaacattaccatttatcacaacccggcctgcggtacgtcacgtaatacgctggagatgatccgcaacagcggtacagaaccgaccattatctattatctggaaacaccaccgacgcgcgatgagctggtaaaactcattgccgatatggggattaccgtacgcgcgctgctacgtaaaaacgtcgagccgtatgaggaactgggccttgcagaagataaatttactcacgatcagttaatcgactttatgcttcagcacccgattctgattaatcgcccgattgtggtgacgccgctgggaactcgcctgtgccgcccttcagaagtcgtgctggaaattctgccagatgcgcaaaaaggcgcgttcaccaaggaagatggcgagaaagtggttgatgaggcgggtaatcgcctgaaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z