BBa_M11080 1 BBa_M11080 silE (coding sequence for Silver binding protein) 2009-04-15T11:00:00Z 2015-05-08T01:13:53Z Joint Genome Institute Gene Object ID 640940792 Chromosome: plasmid pAPEC-O1-R Escherichia coli APEC O1 plasmid pAPEC-O1-R: NC_009838 (241387bp) DNA coordinates: 120874..121422 (-)(549bp) silE is the open reading frame coding for the SilE silver binding protein. It is a small periplasmic protein that selectively binds silver ions. This gene is one of several in a positively regulated silver resistance operon that gives silver resistance through a binding and efflux system. false false _302_ 0 4566 302 Not in stock false PstI Restriction Enzyme site at base pair 463 will need to be mutated if standard biobrick assembly is used. false logan christenson annotation2002311 1 start range2002311 1 1 3 annotation2002313 1 open reading frame range2002313 1 1 546 annotation2002312 1 stop range2002312 1 547 549 BBa_M11080_sequence 1 atgaatatccagtcccctcccggagaaataaacacttccgaacctgtttcagttatggaactgaaaacaccggttgtactcccccggacatcactaattaagaaatggagagttatcatgaaaaatatcgtattagcatccttgctgggctttggcttaatttcttcggcctgggccactgaaaccgtgaatatccatgagcgggtcaacaatgcacaggcacctgctcaccagatgcagtctgctgcggctcctgtcgggatccaggggactgcacctcgtatggccggtatggaccagcatgaacaggccattattgctcatgaaaccatgacgaacgggtcggcggatgcgcaccagaaaatggtggaaagtcatcagaggatgatgggaagtcagaccgtttcccctaccgggccgtcgaagtcattagcggcaatgaatgagcatgaaagagctgcagttgcccatgaatttatgaataacggtcagtctggcccacatcaggccatggccgaagcgcatcgtcgcatgctcagtgcaggctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z