BBa_M11081 1 BBa_M11081 cutA (coding sequence for copper binding protein) 2009-04-15T11:00:00Z 2015-05-08T01:13:53Z Joint Genome Institute: Gene Object ID = 637017462 Escherichia coli K12 DNA coordinates 4363041..4363379 (-)(339bp) Scaffold source: Escherichia coli K12: NC_000913 (4639675bp) cutA is the open reading frame coding for a copper binding protein. It is involved in tolerance to divalent cations such as copper and is natively found in the periplasmic space of E.coli K12. It functions by binding to divalent cations as part of a resistance system. false false _302_ 0 4566 302 Not in stock false No EcoRI, PstI, SpeI, or XbaI restriction sites: Standard biobrick assembly is okay. false logan christenson annotation2002315 1 stop range2002315 1 337 339 annotation2002316 1 open reading frame range2002316 1 1 336 annotation2002314 1 start range2002314 1 1 3 BBa_M11081_sequence 1 atgcttgatgaaaaaagttcgaataccgcgtctgtcgtggtgctatgtacggcaccagatgaagcgacagcccaggatttagccgccaaagtgctggcggaaaaactggcggcctgcgcgaccttgatccccggcgctacctctctctattactgggaaggtaagctggagcaagaatacgaagtgcagatgattttaaaaactaccgtatctcaccagcaggcactgctggaatgcctgaagtctcatcatccatatcaaaccccggaacttctggttttacctgttacacacggagacacagattacctctcatggctcaacgcatctttacgctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z