BBa_M1109 1 BBa_M1109 Hydrocarbon degradation enzyme 2012-04-20T11:00:00Z 2015-05-08T01:13:53Z The DNA sequence was obtained from the organism Pseudomonas putida Enzyme responsible for the intermediate reaction in the conversion of naphthalene to salicylate by bacteria. Naphthalene and more complex fused-ring polycyclic aromatic compounds are metabolized through pathways that often include the formation and cleavage of a 4-substituted 2-ketobut-3-enoate intermediate. false false _768_ 0 12283 9 Not in stock false The DNA sequence was back translated to be used in E. coli using DNA 2.0 gene designer false Elizabeth Martinez annotation2173802 1 start codon range2173802 1 14 16 annotation2173804 1 conding sequence range2173804 1 14 73 annotation2173803 1 stop codon range2173803 1 71 73 BBa_M1109_sequence 1 tatagatttattttaaagggtgcattttgcgttattgagtgtaagaaaaaaataggaaaatagacgataaatgaaaatggaaagagcgagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z