BBa_M11206 1 BBa_M11206 mNarK promoter + RFP to monitor oxygen monitors in S. cerevisiae 2010-04-21T11:00:00Z 2015-05-08T01:13:53Z Composite of the following parts: BBa_K239006, BBa_K165002, BBa_E1010, BBa_J63002 Used in S. cerevisiae to monitor oxygen levels. The promoter, mNarK , is activated under anaerobic condtions. The promoter is followed by the Kozak sequence Ribosome Binding Site. After the RBS, is the RFP sequence codon optimized for S. cerevisiae. It is ended with the ADH1 terminator for S. cerevisiae. false false _572_ 0 6793 9 Not in stock false None. false Angela Dixon component2250138 1 BBa_J63002 component2250136 1 BBa_E1010 component2250133 1 BBa_K165002 component2250132 1 BBa_K239006 annotation2250132 1 BBa_K239006 range2250132 1 1 89 annotation2250138 1 BBa_J63002 range2250138 1 836 1060 annotation2250136 1 BBa_E1010 range2250136 1 122 827 annotation2250133 1 BBa_K165002 range2250133 1 98 115 BBa_K165002 1 BBa_K165002 Kozak sequence (yeast RBS) 2008-10-25T11:00:00Z 2015-05-08T01:10:55Z - Released HQ 2013 The kozak sequence acts as a eukaryotic RBS. It is cloned directly between a promoter and coding region. false false _267_ 0 2512 58 In stock false - false John Szymanski BBa_J63002 1 tADH1 ADH1 terminator from S. cerevisiae 2006-10-10T11:00:00Z 2015-08-31T01:56:26Z genomic DNA of S. cerevisiae ADH1 terminator from S. cerevisiae false true _97_ 0 545 97 It's complicated false starts with stop codon false Caroline Ajo-Franklin annotation1902851 1 ADH1 terminator range1902851 1 1 225 BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation2214014 1 Help:Barcodes range2214014 1 682 706 annotation1014044 1 mrfp1 range1014044 1 1 675 BBa_K239006 1 BBa_K239006 Modified NarK promoter 2009-06-25T11:00:00Z 2015-05-08T01:11:36Z Raw genomic sequence from biocyc, Escherichia coli K-12, but modified. Sequence contains 2 Fnr (one of which is modified), 1 Fis, 2 NarL binding sites and initiates transcription by RNAP sigma-70. Function: Switched on during anaerobic conditions. Area of application: Detection of when the cell is switching to anaerobic metabolism. false false _375_ 0 4247 9 It's complicated false Detect and remove possible restriction sites: XbaI, EcoRI, PstI, SpeI, AgeI, BamHI, BglII, NogMIV, NotI and XhoI. No restriction site had to be removed. Sequence starts 3 bp before the first FNR binding site and ends 6 pb after the -10 box. One pb has been changed in order optimise the first FNR binding site. false Axel Nystrom annotation2006721 1 -35 range2006721 1 48 56 annotation2006723 1 Fis range2006723 1 38 56 annotation2006722 1 Fnr range2006722 1 42 55 annotation2006720 1 -10 range2006720 1 76 83 annotation2006725 1 NarL range2006725 1 20 26 annotation2006726 1 NarL range2006726 1 7 13 annotation2006724 1 Fnr range2006724 1 4 17 BBa_K165002_sequence 1 cccgccgccaccatggag BBa_J63002_sequence 1 taataagcgaatttcttatgatttatgatttttattattaaataagttataaaaaaaataagtgtatacaaattttaaagtgactcttaggttttaaaacgaaaattcttattcttgagtaactctttcctgtaggtcaggttgctttctcaggtatagcatgaggtcgctcttattgaccacacctctaccggcatgccgagcaaatgcctgcaaatcgctccc BBa_M11206_sequence 1 gtattgataaatatcaatgatagataaagttatcttatcgtttgatttacatcaaattgcctttagctacagacactaaggtggcagactactagagcccgccgccaccatggagtactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagtaataagcgaatttcttatgatttatgatttttattattaaataagttataaaaaaaataagtgtatacaaattttaaagtgactcttaggttttaaaacgaaaattcttattcttgagtaactctttcctgtaggtcaggttgctttctcaggtatagcatgaggtcgctcttattgaccacacctctaccggcatgccgagcaaatgcctgcaaatcgctccc BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_K239006_sequence 1 gtattgataaatatcaatgatagataaagttatcttatcgtttgatttacatcaaattgcctttagctacagacactaaggtggcagac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z