BBa_M11402 1 BBa_M11402 5' UTR and RBS of psbA2 gene in Synechocystis sp. PCC 6803 2010-04-23T11:00:00Z 2015-05-08T01:13:53Z Genomic DNA sequence of Synechocystis sp. PCC 6803 Region between promoter and coding sequence of gene psbA2 in Synechocystis sp. PCC 6803. Contains the entire 5' untranslated region (5'UTR) and the RBS, which includes the Shine-Delgarno core consensus sequence (SDS). This part can be used as a RBS part for Synechocystis until a smaller functional consensus RBS is developed. Approximately half of the genes in Synechocystis sp. PCC 6803 are not preceded by the SDS (Sazuka T and Ohara O. 1996. DNA Research 3: 225-232). false true _572_ 0 6788 9 It's complicated false none false Cody Tramp annotation2068490 1 SDS Core Consensus range2068490 1 35 38 annotation2068489 1 5' UTR range2068489 1 1 49 BBa_M11402_sequence 1 agtcagttccaatctgaacatcgacaaatacataaggaattataaccaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z