BBa_M11403 1 BBa_M11403 Type 1 promoter of the cpcBA operon in Synechocystis sp. PCC 6803 2010-04-29T11:00:00Z 2015-05-08T01:13:53Z Genomic sequence as reported in Imamura 2009 Phycocyanin A and B subunit promoter; cpcBA is a photosynthetic light-harvesting bile pigment-protein; absorbs orange/red light at ~620nm and emits ~650nm false false _572_ 0 6789 9 Not in stock false None false Leslie C Mounteer Jr annotation2068736 1 -10 (TATAAT) hexamer range2068736 1 27 32 annotation2068735 1 -35 (TAGACA) hexamer range2068735 1 3 8 annotation2068755 1 promoter range2068755 1 1 39 BBa_M11403_sequence 1 aacagacataagtcccatcaccgttgtataaagttaact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z