BBa_M11404 1 BBa_M11404 Type 1 promoter of psbA2 gene in Synechocystis sp. PCC 6803 2010-04-29T11:00:00Z 2015-05-08T01:13:53Z Genomic sequence as identified in Imamura 2009 Part of photosystem II in S. PCC 6803; Is a group 1 promoter and is recognized by SigD; Imamura 2009 suggests it may potentially be a light-induced promoter and is a reaction center protein of photosystem II false true _572_ 0 6789 9 It's complicated false none false Leslie C Mounteer Jr annotation2068737 1 -35 (TAGACA) Hexamer range2068737 1 3 8 annotation2068756 1 promoter range2068756 1 1 38 annotation2068738 1 -10 (TATAAT) Hexamer range2068738 1 27 32 BBa_M11404_sequence 1 gctttacaaaactctcattaatcctttagactaagttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z