BBa_M11405 1 BBa_M11405 Type 1 promoter of petBD operon in Synechocystis sp. PCC 6803 2010-04-29T11:00:00Z 2015-05-08T01:13:53Z Genomic sequence as identified in Imamura 2009 Both petB and petD mediate electron transfer between photosystemI & II false false _572_ 0 6789 9 Not in stock false none false Leslie C Mounteer Jr annotation2068739 1 -35 (TAGACA) Hexamer range2068739 1 4 9 annotation2068757 1 promoter range2068757 1 1 42 annotation2068740 1 -10 (TATAAT) Hexamer range2068740 1 27 32 BBa_M11405_sequence 1 cctttccccagggcttgaagctgtgttacattttgtgatgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z