BBa_M11406 1 BBa_M11406 Type 1 promoter of psaAB operon in Synechocystis sp. PCC 6803 2010-04-29T11:00:00Z 2015-05-08T01:13:53Z Genomic sequence as identified in Imamura 2009 psaA and psaB are binders of P700 in PSI, Plastocyanin/cytochrome c6-ferredoxin oxidoreductase, transfers electorons from P7000 chlorophyll to A0, A1, FX, FA, and FB. false false _572_ 0 6789 9 Not in stock false none false Leslie C Mounteer Jr annotation2068741 1 -35 (TAGACA) Hexamer range2068741 1 5 10 annotation2068758 1 promoter range2068758 1 1 39 annotation2068742 1 -10 (TATAAT) Hexamer range2068742 1 27 32 BBa_M11406_sequence 1 ggtcttgcctagggggggggaggccgtattatcttctag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z