BBa_M11407 1 BBa_M11407 Type 1 promoter of hspA gene in Synechocystis sp. PCC 6803 2010-04-29T11:00:00Z 2015-05-08T01:13:53Z Genomic sequence as identified in Imamura 2009 Heat Shock protein A has been confirmed by three research groups, it is the target of heat-shock induced by SigB, however, during SigB knockout, approximately 40% is found to remain compared to wild strain. false true _572_ 0 6789 9 It's complicated false none false Leslie C Mounteer Jr annotation2068744 1 -10 (TATAAT) Hexamer range2068744 1 27 32 annotation2068759 1 promoter range2068759 1 1 38 annotation2068743 1 -35 (TAGACA) Hexamer range2068743 1 6 11 BBa_M11407_sequence 1 cgaatctaacctggaaggggaaattttaagatagaacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z