BBa_M11408 1 BBa_M11408 Type 1 promoter of sigA gene in Synechocystis sp. PCC 6803 2010-04-29T11:00:00Z 2015-05-08T01:13:53Z Genomic sequence as identified in Imamura 2009 sigA is self-regulating for SigA, but, has shown down-regulation in transcription due to changes from heat-shock, darkness, and salt stress. SigC knockout has indicated a decrease in sigA, but not direct proportion to the transcript of SigA. false true _572_ 0 6789 9 It's complicated false none false Leslie C Mounteer Jr annotation2068760 1 promoter range2068760 1 1 42 annotation2068746 1 -10 (TATAAT) Hexamer range2068746 1 27 32 annotation2068745 1 -35 (TAGACA) Hexamer range2068745 1 6 11 BBa_M11408_sequence 1 caactttgactgaccagctaattttgtacacgacttaggagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z