BBa_M11409 1 BBa_M11409 Promoter of pglnBP2 gene in Synechocystis sp. PCC 6803. 2010-04-26T11:00:00Z 2015-05-08T01:13:54Z genomic DNA Type 2 promoter of pglnBP2 gene in Synechocystis sp. PCC 6803. This gene plays a role in nitrogen regulation and possibly carbon/nitrogen balance. false true _572_ 0 6792 9 It's complicated false None false Abiezer Tejeda annotation2068732 1 Enhancer range2068732 1 1 13 annotation2068734 1 pglnBP2 promoter range2068734 1 1 48 annotation2068733 1 -10 box range2068733 1 38 43 BBa_M11409_sequence 1 gtactgatttttacaaaaaaacttttggaggacatgttaaaagtgtct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z