BBa_M11410 1 BBa_M11410 Type 2 promoter of sigE gene. Sigma factor regulates light and nitrogen responses, and has been obse 2010-05-06T11:00:00Z 2015-05-08T01:13:54Z Sigma Factors for Cyanobacterial Transcription Sousuke Imamura and Munehiko Asayama Type 2 promoter of sigE gene. Sigma factor regulates light and nitrogen responses, and has been observed to increase with light and decrease in darkness. Promoter potentially regulated by circadian rhythm. SigE specifi cally contributes to the expression of genes related to sugar catabolism and photosynthesis, and is regulated by the circadian system at the transcript and protein levels. Therefore, SigE may be a factor controlling the balance of carbon and nitrogen metabolism with a rhythmic expression that peaks at 24-hour intervals according to the upcoming night. false false _572_ 0 6792 9 Not in stock false none false Abiezer Tejeda BBa_M11410_sequence 1 gtatcacgaattacactgccgtgaaaatttaacgatattttggacag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z