BBa_K190017 1 BBa_K190017 Copper Promoter (CueR regulated) 2009-07-14T11:00:00Z 2015-05-08T01:11:15Z E.coli TOP10 Promoter sequence with recognition site for CueR transcriptional regulator protein. false false _306_ 0 4144 9 It's complicated false None false Michael Verhoeven annotation2011506 1 CueR binding site range2011506 1 3 28 annotation2011505 1 -35 and -10 region range2011505 1 1 43 BBa_E0032 1 YFP enhanced yellow fluorescent protein derived from A. victoria GFP 2003-01-31T12:00:00Z 2015-08-31T04:07:25Z Modified from <bb_part>BBa_E0031</bb_part> Released HQ 2013 Yellow fluorescent protein (EYFP) reporter coding sequence without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. </P> Annotated mutation cause a Q81L mutation that appears to not be near the active site. </P> false false _1_ 0 24 7 In stock false <P> <P>BBa_E0032 yellow fluorescent protein is based on BioBrick part BBa_E0031. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation2159 1 2 range2159 1 757 762 annotation2161 1 A (Q->L) range2161 1 242 242 annotation7041 1 BBa_E0032 range7041 1 1 762 annotation2160 1 SsrA range2160 1 718 756 annotation2156 1 YFP (LVA) range2156 1 1 762 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_M11512 1 BBa_M11512 Copper Promoter (CueR regulated) with YFP Reporter 2010-04-19T11:00:00Z 2015-05-08T01:13:54Z For further information and characterization of the CueO promotor see CueO 1) K. Yamamoto and A. Ishihama (2005) Transcriptional response of Escherichia coli to external copper, Molecular Microbiology, 56(1), 215???227. YFP Yellow fluorescent protein (EYFP) reporter coding sequence without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. Annotated mutation cause a Q81L mutation that appears to not be near the active site. Promoter sequence with recognition site for the CueR transcription regulating protein. When copper levels in the cell rise CueR activates transcription (1) with enhanced yellow fluorescent protein derived from A. victoria GFP. false false _572_ 0 6772 9 Not in stock false Composite Part of BBa_K190017 and BBa_E0032 false Alyssa Calder component2068090 1 BBa_B0010 component2068092 1 BBa_B0012 component2068084 1 BBa_B0034 component2068086 1 BBa_E0032 component2068082 1 BBa_K190017 annotation2068084 1 BBa_B0034 range2068084 1 52 63 annotation2068092 1 BBa_B0012 range2068092 1 928 968 annotation2068082 1 BBa_K190017 range2068082 1 1 43 annotation2068086 1 BBa_E0032 range2068086 1 70 831 annotation2068090 1 BBa_B0010 range2068090 1 840 919 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_E0032_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataa BBa_M11512_sequence 1 ttgaccttcccgtaaggggaaggactatgctcaacgtttgatttactagagaaagaggagaaatactagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K190017_sequence 1 ttgaccttcccgtaaggggaaggactatgctcaacgtttgatt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z