BBa_M11562 1 BBa_M11562 p(CAD1) 2010-04-20T11:00:00Z 2015-05-08T01:13:54Z Saccharomyces cerevisiae genomic sequence Promoter region corresponding to CAD1 false false _572_ 0 5417 9 Not in stock false Altered genetic sequence for improved CAD1 binding false Brad Henrie annotation2067855 1 CAD1 Binding site range2067855 1 13 22 BBa_M11562_sequence 1 tattacatgctcattactaatcttatgtatactcatgtaatgtttatatgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z