BBa_M12067 1 BBa_M12067 E1 2009-05-12T11:00:00Z 2015-05-08T01:13:55Z It comes from the HCV genome. E1 is a membrane protein that comes from HCV. The receptors on the liver recognize this protein, which leads to endocytosis of the particle displaying the E1. The protein can be used for specific targeting to the liver. false false _387_ 0 4677 387 Not in stock true We had to make sure the amino acid sequence produced is the same as the amino acid sequence of E1 that we found online. false Team Uptake--20.020 Group Project BBa_M12067_sequence 1 tggtgggtcccgacgttgacgaggtagatggggccggtgtagtggccggtggcctaccggaccctgtactactacttgaccagggggtggtggcgggaccaccaccgggtcgacgacgcctagggggtccggtaggacctgtactagcggccgcgggtgaccccgcacgaccggccgtagcggatgaagaggtaccacccgttgacccggttccacgaccggcacgacgacgacaagcggccgcacctgcgggccctgggtggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z