BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_J61101 1 BBa_J61101 Ribosome Binding Site Family Member 2007-01-28T12:00:00Z 2015-08-31T02:03:00Z N/A fix false false _95_ 0 483 95 In stock false N/A true John Anderson BBa_K112807 1 BBa_K112807 [T4 antiholin] 2008-10-31T12:00:00Z 2015-05-08T01:09:19Z Enterobacteria phage T4 http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=29366675&from=59202&to=59495&view=gbwithparts Antiholin binds holin and prevents holin multimers from forming pores on the inner membrane of bacteria. false true _224_ 0 3025 171 It's complicated false Higher constitutive expression of antiholin compared to the expression of holin is required for the stable lysis device. false Jin Huh annotation1999019 1 T4 antiholin range1999019 1 15 308 BBa_M1209 1 BBa_M1209 Antiholin portion of kill gene 2011-04-21T11:00:00Z 2015-05-08T01:13:55Z http://2010.igem.org/Team:HKU-Hong_Kong This part includes the promoter, coding region, and terminator of the antiholin gene. false false _768_ 0 8956 9 Not in stock false This design was great false Cameron Copeland component2116995 1 BBa_J61101 component2116997 1 BBa_K112807 component2116994 1 BBa_J23116 component2116998 1 BBa_B0010 annotation2116994 1 BBa_J23116 range2116994 1 1 35 annotation2116995 1 BBa_J61101 range2116995 1 44 55 annotation2116998 1 BBa_B0010 range2116998 1 383 462 annotation2116997 1 BBa_K112807 range2116997 1 64 374 BBa_J23116 1 BBa_J23116 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false false _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J23116_sequence 1 ttgacagctagctcagtcctagggactatgctagc BBa_J61101_sequence 1 aaagacaggacc BBa_M1209_sequence 1 ttgacagctagctcagtcctagggactatgctagctactagagaaagacaggacctactagaggataggaggcctttatggccttaaaagcaacagcactttttgccatgctaggattgtcatttgttttatctccatcgattgaagcgaatgtcgatcctcattttgataaatttatggaatctggtattaggcacgtttatatgctttttgaaaataaaagcgtagaatcgtctgaacaattctatagttttatgagaacgacctataaaaatgacccgtgctcttctgattttgaatgtatagagcgaggcgcggagatggcacaatcatacgctagaattatgaacattaaattggagactgaatgaaattactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K112807_sequence 1 gataggaggcctttatggccttaaaagcaacagcactttttgccatgctaggattgtcatttgttttatctccatcgattgaagcgaatgtcgatcctcattttgataaatttatggaatctggtattaggcacgtttatatgctttttgaaaataaaagcgtagaatcgtctgaacaattctatagttttatgagaacgacctataaaaatgacccgtgctcttctgattttgaatgtatagagcgaggcgcggagatggcacaatcatacgctagaattatgaacattaaattggagactgaatgaaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z