BBa_I14032 1 P(Lac) IQ promoter P(Lac) IQ 2004-08-03T11:00:00Z 2015-08-31T04:07:37Z Plasmid pMAL-p2X Released HQ 2013 Constitutive Promoter, High Transcription false true _4_ 0 171 7 In stock false true Vikram Vijayan, Allen Hsu, Lawrence Fomundam annotation1028344 1 -10 range1028344 1 26 31 annotation1028342 1 P(Lac) IQ range1028342 1 1 37 annotation1028343 1 -35 range1028343 1 3 8 BBa_B0031 1 BBa_B0031 RBS.2 (weak) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Medium RBS based on Ron Weiss thesis. Strength considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false <P> <P>Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-1&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Cho</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23316 1 conserved range23316 1 7 10 BBa_M1265 1 BBa_M1265 Gluteomorphin or gliadorphin 2012-03-27T11:00:00Z 2015-05-08T01:13:55Z web composite false false _768_ 0 12291 9 Not in stock false none false Allie S component2171740 1 BBa_M1258 component2171736 1 BBa_I14032 component2171738 1 BBa_B0031 annotation2171740 1 BBa_M1258 range2171740 1 68 121 annotation2171738 1 BBa_B0031 range2171738 1 46 59 annotation2171736 1 BBa_I14032 range2171736 1 1 37 BBa_M1258 1 BBa_M1258 Gluteomorphin or gliadorphin 2012-03-27T11:00:00Z 2015-05-08T01:13:55Z web based gluten peptide that reacts with opiate receptors false false _768_ 0 12291 9 Not in stock false none false Allie S annotation2171710 1 rbs range2171710 1 1 3 BBa_M1265_sequence 1 tggtgcaaaacctttcgcggtatggcatgatagcgcctactagagtcacacaggaaacctactagagacgtataggcccagagggctgaacccacggggtctgaatccgagaccacatgag BBa_M1258_sequence 1 acgtataggcccagagggctgaacccacggggtctgaatccgagaccacatgag BBa_I14032_sequence 1 tggtgcaaaacctttcgcggtatggcatgatagcgcc BBa_B0031_sequence 1 tcacacaggaaacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z