BBa_M13003 1 BBa_M13003 M13K07 gene III 2006-12-13T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome, encoding a minor coat protein. Approximately 5 copies of p3 are presented with 5 copies of p6 on the rounded end of the mature phage. In the absence of p3, the phage remains tethered to the bacterial host, elongating to 10 or 20 times the normal phage length and incorporating multiple ssDNA genomes within the coat. p3 (domain II) is also responsible for the initial interaction of the phage with the bacterial pili during infection. Peptide fusions, sometimes large, can be displayed on N-terminal end of p3, though highly charged fusions are difficult to isolate since they are not easily secreted by the host secretion apparatus. The p3 protein is first synthesized as a longer precursor protein that is 18 amino acids longer than the mature protein. The gene's translation initiates with a GTG codon, and changing this codon to an ATG increases expression of gene III to levels with negative effects on phage maturation. false false _45_ 0 314 1 Not in stock false The RBS for gene III is within the transcription termination sequence of the upstream gVIII, thus modifications to termination affect gIII initiation. Translation initiates with a GTG rather than a canonical ATG. There is a unique, natural BamHI site in domain II that may be useful for cloning, though it may prevent interaction of p3 with pilus. false Natalie Kuldell BBa_M13003_sequence 1 gtgaaaaaattattattcgcaattcctttagttgttcctttctattctcactccgctgaaactgttgaaagttgtttagcaaaaccccatacagaaaattcatttactaacgtctggaaagacgacaaaactttagatcgttacgctaactatgagggttgtctgtggaatgctacaggcgttgtagtttgtactggtgacgaaactcagtgttacggtacatgggttcctattgggcttgctatccctgaaaatgagggtggtggctctgagggtggcggttctgagggtggcggttctgagggtggcggtactaaacctcctgagtacggtgatacacctattccgggctatacttatatcaaccctctcgacggcacttatccgcctggtactgagcaaaaccccgctaatcctaatccttctcttgaggagtctcagcctcttaatactttcatgtttcagaataataggttccgaaataggcagggggcattaactgtttatacgggcactgttactcaaggcactgaccccgttaaaacttattaccagtacactcctgtatcatcaaaagccatgtatgacgcttactggaacggtaaattcagagactgcgctttccattctggctttaatgaggatccattcgtttgtgaatatcaaggccaatcgtctgacctgcctcaacctcctgtcaatgctggcggcggctctggtggtggttctggtggcggctctgagggtggtggctctgagggtggcggttctgagggtggcggctctgagggaggcggttccggtggtggctctggttccggtgattttgattatgaaaagatggcaaacgctaataagggggctatgaccgaaaatgccgatgaaaacgcgctacagtctgacgctaaaggcaaacttgattctgtcgctactgattacggtgctgctatcgatggtttcattggtgacgtttccggccttgctaatggtaatggtgctactggtgattttgctggctctaattcccaaatggctcaagtcggtgacggtgataattcacctttaatgaataatttccgtcaatatttaccttccctccctcaatcggttgaatgtcgcccttttgtctttagcgctggtaaaccatatgaattttctattgattgtgacaaaataaacttattccgtggtgtctttgcgtttcttttatatgttgccacctttatgtatgtattttctacgtttgctaacatactgcgtaataaggagtcttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z