BBa_M13006 1 BBa_M13006 M13K07 gene VI 2006-12-13T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome, encoding a minor coat protein. Approximately 5 copies of p6 are presented with 5 copies of p3 on the rounded end of the mature phage. In the absence of p6, the phage remains tethered to the bacterial host, elongating to 10 or 20 times the normal phage length and incorporating multiple ssDNA genomes within the coat. p6 is particularly hydrophobic. false false _45_ 0 314 1 Not in stock false RBS within upstream gIII false Natalie Kuldell BBa_M13006_sequence 1 atgccagttcttttgggtattccgttattattgcgtttcctcggtttccttctggtaactttgttcggctatctgcttacttttcttaaaaagggcttcggtaagatagctattgctatttcattgtttcttgctcttattattgggcttaactcaattcttgtgggttatctctctgatattagcgctcaattaccctctgactttgttcagggtgttcagttaattctcccgtctaatgcgcttccctgtttttatgttattctctctgtaaaggctgctattttcatttttgacgttaaacaaaaaatcgtttcttatttggattgggataaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z