BBa_M13007 1 BBa_M13007 M13K07 gene VII 2006-12-11T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome. It encodes a protein that is presented with p9 to initiate phage assembly at the blunt end of the phage coat. Approximately 5 copies of each protein are presented on mature phage. Without p9 or p7, no phage is produced. p7 is one of the smallest ribosomally translated proteins with described function. It is hydrophobic and the N-terminus is negatively charged, suggesting a C-terminus inside orientation. false true _45_ 0 314 1 Not in stock false stop codon overlaps with p9 start codon in M13 genome. false Natalie Kuldell BBa_M13007_sequence 1 atggagcaggtcgcggatttcgacacaatttatcaggcgatgatacaaatctccgttgtactttgtttcgcgcttggtataatcgctgggggtcaaagatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z