BBa_M13008 1 BBa_M13008 M13KO7 gene VIII 2006-12-12T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome. It encodes the major coat protein, with approximately 2700 copies of the protein on each phage particle. The protein is first synthesized at a longer precursor protein that is clipped between the Alanines at positions 23 and 24. It is possible to silently add a Pst site to clone fusions upstream and in frame with Ala that begins mature protein. Small peptide-fusions are possible to the N-terminal portion of the mature p8 (phage display systems are built around this finding) but addition of more than 6 or 8 residues makes the phage pack poorly, leading to unproductive infections. false true _45_ 0 314 1 In stock false Many! The start codon for gene 8 overlaps with the stop codon for the upstream gene 9. Might be nice to include cloning sites for directed N-terminal fusions to mature form of protein. Might be nice to codon vary a different biobrick of gene VIII to allow for two genes expressed on single genome, inhibiting recombination in ssDNA. false Natalie Kuldell BBa_M13008_sequence 1 atgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaattcacctcgaaagcaagctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z