BBa_M13009 1 BBa_M13009 M13K07 gene IX 2006-12-11T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This gene is part of the bacteriophage M13 genome. It encodes a protein that is presented with p7 to initiate phage assembly at the blunt end of the phage coat. Approximately 5 copies of each protein are presented on mature phage. In the absence of p9 or p7, no phage is produced. p9 is one of the smallest ribosomally translated proteins with described function. N-terminal display is possible, and some positively charged residues are seen at the C-terminal end of the protein, suggesting a "C-terminus inside" orientation. false true _45_ 0 314 1 Not in stock false start codon overlaps with stop codon of g7 upstream and stop codon overlaps with start codon of g8 downstream. false Natalie Kuldell BBa_M13009_sequence 1 atgagtgttttagtgtattctttcgcctctttcgttttaggttggtgccttcgtagtggcattacgtattttacccgtttaatggaaacttcctcatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z