BBa_M13105 1 BBa_M13105 M13K07 gene V promoter 2006-12-15T12:00:00Z 2015-05-08T01:13:55Z New England Biolabs M13K07. Sequenced in 2002 by L. Panganaban. This part is from the bacteriophage M13 genome, bp 786-835 in M13K07. It directs transcription of M13 gene V (BBa_M13505, BBa_M13005). Its identity as a promoter was described in Gene (1980) 11:129-148 based on -10,-35 homology and fragment of genome able to bind RNAP. false false _45_ 0 314 1 Not in stock false none false Natalie Kuldell BBa_M13105_sequence 1 ccaacgtcctgactggtataatgagccagttcttaaaatcgcataaggta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z